rrid bag3 primary antibody proteintech (Proteintech)

Proteintech is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Proteintech rrid bag3 primary antibody proteintech
Rrid Bag3 Primary Antibody Proteintech, supplied by Proteintech, used in various techniques. Bioz Stars score: 97/100, based on 8090 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/%CE%B2+actin+proteintech/beta+Actin+Monoclonal+antibody/pm41911062-140-7-11
Average 97 stars, based on 8090 article reviews

rrid bag3 primary antibody proteintech - by Bioz Stars, 2026-09

97/100 stars

Images

FLAG-tag:

Article Title: The USP35-CXCR3 Axis plays an oncogenic role in JeKo-1 mantle cell lymphoma cells.
Article Snippet: .. Primary antibody USP35 Proteintech (China) 24 559–1-AP 1:3000 CXCR3 Proteintech (China) 26 756–1-AP 1:3000 JAK1 Proteintech (China) 66 466–1-Ig 1:3000 p-JAK1 Abcam (UK) ab138005 1:3000 STAT1 Proteintech (China) 10 144–2-AP 1:3000 p-STAT1 Proteintech (China) 28 977–1-AP 1:3000 β-catenin Proteintech (China) 80 067–1-RR 1:3000 c-Myc Immunoway (USA) YM0991 1:3000 Bcl2 Dianyin (China) 024–765 1:3000 Cleaved-caspase 3 Cell Signaling Technology (USA) #9661 1:3000 Bax Immunoway (USA) YM3619 1:3000 β-actin Proteintech (China) 20 536–1-AP 1:5000 Flag Tag Proteintech (China) 20 543–1-AP 1:20000 ubiquitin Proteintech (China) 10 201–2-AP 1:1000 GAPDH Proteintech (China) 60 004–1-Ig 1:5000 Second antibody HRP-Anti-Rabbit IgG Proteintech (China) SA00001–2 1:10000 HRP-Anti-Mouse IgG Proteintech (China) SA00001–1 1:10000 Table 3. ..

Ubiquitin Proteomics:

other:

Article Title: A sophisticated mechanism governs Pol ζ activity in response to replication stress
Article Snippet: Antibodies used in this study Targeted Polypeptides Source Identifier/Description Verification Dilution ATM Abclonal Cat# A19650 Manufacturer tested in WB WB, 1:2000 ATR Cell signaling technology Cat# 2790s Manufacturer tested in WB WB, 1:1000 Biotin Jackson immunoresearch labs Cat# 200-002-211 Manufacturer tested in IF IF/PLA, 1:500 FLAG-tag Sigma-aldrich Cat# F3165 Manufacturer tested in WB WB, 1:5000 MCM3 Abclonal Cat# A11475 Manufacturer tested in WB WB, 1:2000 REV1 Santa cruz biotechnology Cat# sc-48806 Manufacturer tested in WB WB, 1:1000 REV7 Abclonal Cat# A4630 Manufacturer tested in WB WB, 1:2000 Ub-K48 Abcam Cat# ab140601 Manufacturer tested in WB WB, 1:2000 β-actin Proteintech Cat# 66009-1-ig Manufacturer tested in WB WB, 1:2000 γ-H2AX Millipore Cat# 05-636 Manufacturer tested in WB and IF WB, 1:5000 pChk1(S317) Cell signaling technology Cat# 12302 Manufacturer tested in WB WB, 1:2000 pRPA(T21) Abcam Cat# ab109394 Manufacturer tested in WB and IF WB, 1:2000 REV3L-N70 Lab stock Antigen: human REV3L 327-525 a.a.

Article Title: Interleukin-1 prevents SARS-CoV-2-induced membrane fusion to restrict viral transmission via induction of actin bundles
Article Snippet: DOI: https://doi.org/10.7554/eLife.98593 21 of 29 Reagent type (species) or resource Designation Source or reference Identifiers Additional information Recombinant protein Recombinant human IL- 1RA Peprotech 200- 01RA 1000 ng/mL Recombinant protein Recombinant human IL- 6 Peprotech 200- 06 100 ng/mL Recombinant protein Recombinant human IL- 8 Peprotech 200- 08M 100 ng/mL Recombinant protein Recombinant mouse IL- 1RA BioLegend 769706 In vivo: 150 μg/kg Commercial assay or kit Human IL- 1β ELISA kit R&D Systems DY201 N/A Commercial assay or kit RhoA pull- down activation assay Biochem kit Cytoskeleton BK036- S N/A Recombinant DNA reagent pVAX1 SARS- CoV- 2 spike (Wild type) plasmid This paper GenBank: QHD43419.1 Homo sapiens codon- optimized, HA- tag at the C- terminal Recombinant DNA reagent pVAX1 SARS- CoV- 2 spike (Alpha) plasmid This paper N/A Truncated 19 amino acids at the Cterminal Recombinant DNA reagent pVAX1 SARS- CoV- 2 spike (Beta) plasmid This paper N/A Truncated 19 amino acids at the Cterminal Recombinant DNA reagent pVAX1 SARS- CoV- 2 spike (Delta) plasmid This paper N/A Truncated 19 amino acids at the Cterminal Recombinant DNA reagent pVAX1 SARS- CoV- 2 spike (Omicron) plasmid GeneScript N/A Truncated 19 amino acids at the Cterminal Recombinant DNA reagent pcDNA4.0 human ACE2 plasmid This paper N/A V5- tag at the C- terminal Recombinant DNA reagent GFP- AHPH plasmid Addgene Cat#:71368, RRID:Addgene_71368 N/A Recombinant DNA reagent pRK5myc RhoA L63 plasmid Addgene Cat#:15900, RRID:Addgene_15900 N/A Sequence- based reagent PCR primers This paper PCR primers See Supplementary file 1 for primers used in this study Sequence- based reagent sgRNA primers This paper sgRNA primers See Supplementary file 2 for sgRNA primers used in this study Continued

Article Title: Resveratrol delays senescence of human dental pulp stem cells via activating the SIRT1-mitochondrial autophagy.
Article Snippet: Horseradish peroxidase-labeled secondary antibody (1:5000, Abcam, Cambridge, UK) was employed to treat proteins for 2 h at room temperature.

Article Title: High mobility group A1 (HMGA1) promotes esophageal squamous cell carcinoma progression by inhibiting STING-mediated anti-tumor immunity
Article Snippet: Sequences of siRNAs for knocking down genes Antibody Company (Cat. No.) Working dilutions HMGA1 Abcam (ab129153) WB: 1:10,000; IHC: 1:500 HMGA1 Abcam (ab252930) ChIP: 1:50 HMGA1 Santa Cruz (sc-393213) WB: 1/1,000; IHC:1:400; IP: 1:200 STING Cell Signaling Technology(#13647) WB: 1:1,000; IHC: 1:200; IP: 1:50 p-STING Cell Signaling Technology(#50907S) WB: 1:1,000 TBK1 Cell Signaling Technology(#3504) WB: 1:1,000 p-TBK1 Cell Signaling Technology(#5483) WB: 1:1,000 IRF3 Proteintech (11312-1-AP) WB: 1:1,000; IF: 1:100 p-IRF3 Cell Signaling Technology(#4947) WB: 1:1,000 CREB Cell Signaling Technology(#9197) WB: 1:1,000; IP: 1:50; ChIP: 1:50 cGAS Santa Cruz (sc-515777) WB: 1:1,000 p300 Santa Cruz (sc-32244) WB: 1:1,000 AKT Cell Signaling Technology(#4691) WB: 1:1,000 p-AKT Cell Signaling Technology(#4060) WB: 1:1,000 mTOR Cell Signaling Technology(#2983) WB: 1:1,000 p-mTOR Cell Signaling Technology(#5536) WB: 1:1,000 PI3K p85α Proteintech (60225-1-lg) WB: 1:1,000 PI3K p110α Proteintech (67071-1-lg) WB: 1:1,000 CXCL10 Proteintech (10937-1-AP) IHC: 1:200 CCL5 Proteintech (12000-1-AP) IHC: 1:100 CD3 Abcam (ab16669) WB: 1:1,000; IHC: 1:150 CD8 Abcam (ab217344) WB: 1:1,000; IHC: 1:500 GZMB Santa Cruz (sc-8022) WB: 1:1,000; IHC: 1:200 β-actin Proteintech (66009-1-Ig) WB: 1/10,000 GAPDH Proteintech (60004-1-Ig) WB: 1/50,000 Supplementary Fig. 1a.

Western Blot:

Article Title: High mobility group A1 (HMGA1) promotes the tumorigenesis of colorectal cancer by increasing lipid synthesis
Article Snippet: .. shHMGA1-1 GAAGTGCCAACACCTAAGAGA shHMGA1-2 TGAGTGAGTCGAGCTCGAAGT CPT1A Proteintech (15184-1-AP) WB: 1/1,000 SREBP1 Proteintech (14088-1-AP) WB: 1/2,000; IF:1/200 PI3K ZENBIO (R22768) WB: 1:1,000 p-PI3K ZENBIO (310164) WB: 1:1,000 AKT Cell Signaling Technology (4691) WB: 1:1,000 p-AKT (Ser473) Cell Signaling Technology (4060) WB: 1:1,000 mTOR Cell Signaling Technology (2983) WB: 1:1,000 p-mTOR (Ser2448) Cell Signaling Technology (5536) WB: 1:1,000 c-Myc Cell Signaling Technology (13987S) WB: 1:1,000 ACC1 ZENBIO (R381131) WB: 1:1,000 ACLY ZENBIO (R23558) WB: 1:1,000 β-actin Proteintech (66009-1-Ig) WB: 1/10,000 ..

Article Title: DAZAP1 maintains gastric cancer stemness by inducing mitophagy
Article Snippet: .. Antibody Company (Cat. No.) Working Concentration Dilutions DAZAP1 Zenbio(R24078) WB: 1/2000; IHC:1/500; IP:5ug; IF:1/200 ULK1 Zenbio(381887) WB: 1/1000 OCT4 Abclonal(A25315) WB: 1/1000 SOX2 Abclonal(A11501) WB: 1/1000 NANOG Abclonal(A22625) WB: 1/1000 hnRNPA1 Abclonal(A11564) WB: 1/1000 P62 Zenbio(R25788) WB: 1/1000 LC3B Zenbio(350140) WB: 1/300 β-actin Proteintech (20536-1-AP) WB: 1/3000 a-Tubulin Proteintech (11224-1-AP) WB: 1/3000 IgG control Proteintech (30000-0-AP) IP:5ug Supplementary Table 5. ..

Review

rrid bag3 primary antibody proteintech (Proteintech)

Structured Review

Images

Related Articles

FLAG-tag:

Ubiquitin Proteomics:

other:

Western Blot:

Concentration Assay:

Immunohistochemistry:

Control:

Similar Products

Image Search Results